The importance of diagnostic cytogenetics on outcome in AML: analysis of 1,612 patients entered into the MRC AML 10 trial. The Medical Research Council Adult and Children’s Leukaemia Working Parties.

Cytogenetics is considered one of the most valuable prognostic determinants in acute myeloid leukemia (AML). However, many studies on which this assertion is based were limited by relatively small sample sizes or varying treatment approach, leading to conflicting data regarding the prognostic implications of specific cytogenetic abnormalities. The Medical Research Council (MRC) AML 10 trial, which included children and adults up to 55 years of age, not only affords the opportunity to determine the independent prognostic significance of pretreatment cytogenetics in the context of large patient groups receiving comparable therapy, but also to address their impact on the outcome of subsequent transplantation procedures performed in first complete remission (CR).

On the basis of response to induction treatment, relapse risk, and overall survival, three prognostic groups could be defined by cytogenetic abnormalities detected at presentation in comparison with the outcome of patients with normal karyotype.

AML associated with t(8;21), t(15;17) or inv(16) predicted a relatively favorable outcome. Whereas in patients lacking these favorable changes, the presence of a complex karyotype, -5, del(5q), -7, or abnormalities of 3q defined a group with relatively poor prognosis. The remaining group of patients including those with 11q23 abnormalities, +8, +21, +22, del(9q), del(7q) or other miscellaneous structural or numerical defects not encompassed by the favorable or adverse risk groups were found to have an intermediate prognosis.

ADD1 antibody

20R-2353 50 ug
EUR 281
Description: Rabbit polyclonal ADD1 antibody

ADD1 antibody

70R-30557 100 ug
EUR 327
Description: Rabbit polyclonal ADD1 antibody

ADD1 antibody

70R-31329 100 ug
EUR 327
Description: Rabbit polyclonal ADD1 antibody

ADD1 antibody

70R-15595 50 ul
EUR 435
Description: Rabbit polyclonal ADD1 antibody

ADD1 Antibody

32329-100ul 100ul
EUR 252

ADD1 Antibody

1-CSB-PA001348ESR1HU
  • EUR 222.00
  • EUR 335.00
  • 100ul
  • 50ul
  • Form: Liquid
  • Buffer: PBS with 0.02% sodium azide, 50% glycerol, pH7.3. Antigen Affinity Purified
Description: A polyclonal antibody against ADD1. Recognizes ADD1 from Human. This antibody is Unconjugated. Tested in the following application: ELISA, IHC; Recommended dilution: IHC:1:20-1:200

ADD1 Antibody

1-CSB-PA001348GA01HU
  • EUR 597.00
  • EUR 333.00
  • 150ul
  • 50ul
  • Form: Liquid
  • Buffer: PBS with 0.1% Sodium Azide, 50% Glycerol, pH 7.3. -20℃, Avoid freeze / thaw cycles. Antigen Affinity Purified
Description: A polyclonal antibody against ADD1. Recognizes ADD1 from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC

ADD1 Antibody

1-CSB-PA985327
  • EUR 317.00
  • EUR 244.00
  • 100ul
  • 50ul
  • Form: Liquid
  • Buffer: -20°C, pH7.4 PBS, 0.05% NaN3, 40% Glycerol Antigen affinity purification
Description: A polyclonal antibody against ADD1. Recognizes ADD1 from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, IHC;ELISA:1:500-1:5000, IHC:1:50-1:200

ADD1 Antibody

DF6484 200ul
EUR 304
Description: ADD1 Antibody detects endogenous levels of total ADD1.

ADD1 Antibody

1-CSB-PA274173
  • EUR 317.00
  • EUR 244.00
  • 100ul
  • 50ul
  • Form: Liquid
  • Buffer: -20°C, pH7.4 PBS, 0.05% NaN3, 40% Glycerol Antigen affinity purification
Description: A polyclonal antibody against ADD1. Recognizes ADD1 from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, IHC;ELISA:1:500-1:5000, IHC:1:50-1:200

ADD1 Antibody

1-CSB-PA006900
  • EUR 222.00
  • EUR 195.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Liquid in PBS containing 50% glycerol, 0.5% BSA and 0.02% sodium azide. The antibody was affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogen.
Description: A polyclonal antibody against ADD1. Recognizes ADD1 from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: IHC, IF, ELISA;IHC:1/100-1/300.IF:1/200-1/1000.ELISA:1/10000

ADD1 antibody

70R-51430 100 ul
EUR 244
Description: Purified Polyclonal ADD1 antibody

ADD1 Antibody

AF6276 200ul
EUR 304
Description: ADD1 Antibody detects endogenous levels of total ADD1.

ADD1 siRNA

20-abx900187
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

ADD1 siRNA

20-abx906840
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

ADD1 siRNA

20-abx906841
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

ADD1 Antibody

ABF6276 100 ug
EUR 438

ADD1 Antibody

ABD6484 100 ug
EUR 438

ADD1 antibody (Ser726)

70R-30556 100 ug
EUR 327
Description: Rabbit polyclonal ADD1 antibody (Ser726)

ADD1 antibody (Thr445)

70R-31328 100 ug
EUR 327
Description: Rabbit polyclonal ADD1 antibody (Thr445)

ADD1 Rabbit pAb

A1592-100ul 100 ul
EUR 308

ADD1 Rabbit pAb

A1592-200ul 200 ul
EUR 459

ADD1 Rabbit pAb

A1592-20ul 20 ul
EUR 183

ADD1 Rabbit pAb

A1592-50ul 50 ul
EUR 223

ADD1/ADD2 Antibody

1-CSB-PA000825
  • EUR 222.00
  • EUR 195.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Liquid in PBS containing 50% glycerol, 0.5% BSA and 0.02% sodium azide. The antibody was affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogen.
Description: A polyclonal antibody against ADD1/ADD2. Recognizes ADD1/ADD2 from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: WB, IHC, IP, IF, ELISA;WB:1/500-1/2000.IHC:1/100-1/300.IP:2-5ug/mglysate.IF:1/200-1/1000.ELISA:1/40000

ADD1 Blocking Peptide

DF6484-BP 1mg
EUR 195

ADD1 antibody (Ser726)

70R-37256 100 ug
EUR 349
Description: Rabbit Polyclonal ADD1 antibody (Ser726)

ADD1 (pS726) Antibody

abx010351-100ug 100 ug
EUR 439
  • Shipped within 5-10 working days.

Polyclonal ADD1 Antibody

APR14816G 0.05ml
EUR 484
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human ADD1 . This antibody is tested and proven to work in the following applications:

ADD1 Blocking Peptide

AF6276-BP 1mg
EUR 195

ADD1 / ADD2 Antibody

20-abx329729
  • EUR 314.00
  • EUR 244.00
  • 100 ug
  • 50 ug
  • Shipped within 5-10 working days.

ADD1 cloning plasmid

CSB-CL001348HU-10ug 10ug
EUR 233
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 1203
  • Sequence: atgaatggtgattctcgtgctgcggtggtgacctcaccacccccgaccacagcccctcacaaggagaggtacttcgaccgagtagatgagaacaacccagagtacttgagggagaggaacatggcaccagaccttcgccaggacttcaacatgatggagcaaaagaagagggtgt
  • Show more
Description: A cloning plasmid for the ADD1 gene.

ADD1 Polyclonal Antibody

ABP53674-003ml 0.03ml
EUR 158
  • Immunogen information: Synthesized peptide derived from human Adducin ? around the non-phosphorylation site of T445
  • Applications tips:
Description: A polyclonal antibody for detection of ADD1 from Human, Mouse, Rat. This ADD1 antibody is for IHC-P, IF, ELISA. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from human Adducin ? around the non-phosphorylation site of T445

ADD1 Polyclonal Antibody

ABP53674-01ml 0.1ml
EUR 289
  • Immunogen information: Synthesized peptide derived from human Adducin ? around the non-phosphorylation site of T445
  • Applications tips:
Description: A polyclonal antibody for detection of ADD1 from Human, Mouse, Rat. This ADD1 antibody is for IHC-P, IF, ELISA. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from human Adducin ? around the non-phosphorylation site of T445

ADD1 Polyclonal Antibody

ABP53674-02ml 0.2ml
EUR 414
  • Immunogen information: Synthesized peptide derived from human Adducin ? around the non-phosphorylation site of T445
  • Applications tips:
Description: A polyclonal antibody for detection of ADD1 from Human, Mouse, Rat. This ADD1 antibody is for IHC-P, IF, ELISA. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from human Adducin ? around the non-phosphorylation site of T445

Anti-ADD1 Antibody

A1744-100
EUR 479

ADD1 (pS726) Antibody

20-abx000248
  • EUR 495.00
  • EUR 704.00
  • EUR 356.00
  • 100 ul
  • 200 ul
  • 50 ul
  • Shipped within 5-10 working days.

ADD1 Polyclonal Antibody

ES4673-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against ADD1 from Human/Mouse/Rat. This antibody is tested and validated for IHC, IF, WB, ELISA

ADD1 Polyclonal Antibody

ES4673-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against ADD1 from Human/Mouse/Rat. This antibody is tested and validated for IHC, IF, WB, ELISA

Anti-ADD1 antibody

STJ91489 200 µl
EUR 197
Description: Rabbit polyclonal to ADD1.

Anti-ADD1 antibody

STJ22515 100 µl
EUR 277
Description: Adducins are a family of cytoskeleton proteins encoded by three genes (alpha, beta, gamma). Adducin is a heterodimeric protein that consists of related subunits, which are produced from distinct genes but share a similar structure. Alpha- and beta-adducin include a protease-resistant N-terminal region and a protease-sensitive, hydrophilic C-terminal region. Alpha- and gamma-adducins are ubiquitously expressed. In contrast, beta-adducin is expressed at high levels in brain and hematopoietic tissues. Adducin binds with high affinity to Ca(2+)/calmodulin and is a substrate for protein kinases A and C. Alternative splicing results in multiple variants encoding distinct isoforms; however, not all variants have been fully described.

ADD1 (Ab-726) Antibody

21189-100ul 100ul
EUR 252

ADD1 (Ab-726) Antibody

21189-50ul 50ul
EUR 187

ADD1 (Ab-726) Antibody

33115-100ul 100ul
EUR 252

ADD1 (Ab-726) Antibody

33115-50ul 50ul
EUR 187

ADD1 (Phospho-Ser726) Antibody

11182-100ul 100ul
EUR 252

ADD1 (Phospho-Ser726) Antibody

11182-50ul 50ul
EUR 187

Polyclonal ADD1 Antibody (S726)

APG03120G 0.1 mg
EUR 484
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human ADD1 (S726). This antibody is tested and proven to work in the following applications:

Phospho-ADD1 (Ser726) Antibody

CSB-PA557123-
EUR 335
  • Form: liquid
  • Buffer: Supplied at 1.0mg/mL in phosphate buffered saline (without Mg2+ and Ca2+), pH 7.4, 150mM NaCl, 0.02% sodium azide and 50% glycerol. Antibodies were produced by immunizing rabbits with synthetic phosphopeptide and KLH conjugates.
  • Show more
Description: A polyclonal antibody against Phospho-ADD1 (Ser726). Recognizes Phospho-ADD1 (Ser726) from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC, IF;WB:1:500-1:1000, IHC:1:50-1:100, IF:1:100-1:200

Phospho-ADD1 (Ser726) Antibody

CSB-PA557123-100ul 100ul
EUR 362
  • Form: liquid
  • Buffer: Supplied at 1.0mg/mL in phosphate buffered saline (without Mg2+ and Ca2+), pH 7.4, 150mM NaCl, 0.02% sodium azide and 50% glycerol. Antibodies were produced by immunizing rabbits with synthetic phosphopeptide and KLH conjugates.
  • Show more
Description: A polyclonal antibody against Phospho-ADD1 (Ser726). Recognizes Phospho-ADD1 (Ser726) from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC, IF;WB:1:500-1:1000, IHC:1:50-1:100, IF:1:100-1:200

ADD1 (Ab-726) Antibody

CSB-PA570375-
EUR 335
  • Form: liquid
  • Buffer: Rabbit IgG in phosphate buffered saline (without Mg2+ and Ca2+), pH 7.4, 150mM NaCl, 0.02% sodium azide and 50% glycerol. The antibody was affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific
  • Show more
Description: A polyclonal antibody against ADD1 (Ab-726). Recognizes ADD1 (Ab-726) from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC, IF;WB:1:500-1:3000, IHC:1:50-1:100, IF:1:100-1:500

ADD1 (Ab-726) Antibody

CSB-PA570375-100ul 100ul
EUR 316
  • Form: liquid
  • Buffer: Rabbit IgG in phosphate buffered saline (without Mg2+ and Ca2+), pH 7.4, 150mM NaCl, 0.02% sodium azide and 50% glycerol. The antibody was affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific
  • Show more
Description: A polyclonal antibody against ADD1 (Ab-726). Recognizes ADD1 (Ab-726) from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC, IF;WB:1:500-1:3000, IHC:1:50-1:100, IF:1:100-1:500

ADD1 (Ab-726) Antibody

CSB-PA592573-
EUR 335
  • Form: liquid
  • Buffer: Supplied at 1.0mg/mL in phosphate buffered saline (without Mg2+ and Ca2+), pH 7.4, 150mM NaCl, 0.02% sodium azide and 50% glycerol. Antibodies were produced by immunizing rabbits with synthetic peptide and KLH conjugates. Antibo
  • Show more
Description: A polyclonal antibody against ADD1 (Ab-726). Recognizes ADD1 (Ab-726) from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC, IF;WB:1:500-1:1000, IHC:1:50-1:200, IF:1:100-1:200

ADD1 (Ab-726) Antibody

CSB-PA592573-100ul 100ul
EUR 316
  • Form: liquid
  • Buffer: Supplied at 1.0mg/mL in phosphate buffered saline (without Mg2+ and Ca2+), pH 7.4, 150mM NaCl, 0.02% sodium azide and 50% glycerol. Antibodies were produced by immunizing rabbits with synthetic peptide and KLH conjugates. Antibo
  • Show more
Description: A polyclonal antibody against ADD1 (Ab-726). Recognizes ADD1 (Ab-726) from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC, IF;WB:1:500-1:1000, IHC:1:50-1:200, IF:1:100-1:200

Phospho-ADD1 (T445) Antibody

1-CSB-PA006899
  • EUR 222.00
  • EUR 195.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Liquid in PBS containing 50% glycerol, 0.5% BSA and 0.02% sodium azide. The antibody was affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogen.
Description: A polyclonal antibody against Phospho-ADD1 (T445). Recognizes Phospho-ADD1 (T445) from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: IHC, ELISA;IHC:1/100-1/300.ELISA:1/5000

Alpha-Adducin (ADD1) Antibody

abx010352-100ug 100 ug
EUR 439
  • Shipped within 5-10 working days.

Alpha-Adducin (ADD1) Antibody

abx224142-100ug 100 ug
EUR 411
  • Shipped within 5-10 working days.

Adducin 1 (ADD1) Antibody

20-abx110834
  • EUR 732.00
  • EUR 398.00
  • 150 ul
  • 50 ul
  • Shipped within 5-10 working days.

Adducin 1 (ADD1) Antibody

20-abx130606
  • EUR 439.00
  • EUR 133.00
  • EUR 1233.00
  • EUR 592.00
  • EUR 328.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-7 working days.

Adducin 1 (ADD1) Antibody

20-abx130607
  • EUR 425.00
  • EUR 133.00
  • EUR 1205.00
  • EUR 578.00
  • EUR 328.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-7 working days.

Alpha-Adducin (ADD1) Antibody

abx148001-100ug 100 ug
EUR 439
  • Shipped within 5-10 working days.

ADD1 (Phospho-Ser726) Antibody

20-abx012401
  • EUR 314.00
  • EUR 98.00
  • EUR 398.00
  • EUR 495.00
  • 100 ug
  • 10 ug
  • 200 ug
  • 300 µg
  • Shipped within 5-10 working days.

Adducin 1 (ADD1) Antibody

20-abx242435
  • EUR 411.00
  • EUR 300.00
  • 100 ul
  • 50 ul
  • Shipped within 5-10 working days.

Adducin 1 (ADD1) Antibody

20-abx242436
  • EUR 411.00
  • EUR 300.00
  • 100 ul
  • 50 ul
  • Shipped within 5-10 working days.

Polyclonal ADD1 Antibody (Ser726)

APR14819G 0.05mg
EUR 484
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human ADD1 (Ser726). This antibody is tested and proven to work in the following applications:

Phospho-ADD1 (Ser726) Antibody

AF3276 200ul
EUR 304
Description: Phospho-ADD1 (Ser726) Antibody detects endogenous levels of ADD1 only when phosphorylated at Serine 726.

Rat ADD1 shRNA Plasmid

20-abx984360
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

Alpha-Adducin (ADD1) Antibody

20-abx320155
  • EUR 300.00
  • EUR 244.00
  • 100 ul
  • 50 ul
  • Shipped within 5-10 working days.

Adducin 1 (ADD1) Antibody

abx332016-100ul 100 ul
EUR 425
  • Shipped within 5-10 working days.

Adducin 1 (ADD1) Antibody

abx332311-100ul 100 ul
EUR 425
  • Shipped within 5-10 working days.

Adducin 1 (ADD1) Antibody

20-abx326704
  • EUR 314.00
  • EUR 244.00
  • 100 ug
  • 50 ug
  • Shipped within 5-10 working days.

Human ADD1 shRNA Plasmid

20-abx950080
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

Mouse ADD1 shRNA Plasmid

20-abx969047
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

Phospho- ADD1 (Ser726) Antibody

ABF3276 100 ug
EUR 438

Alpha-Adducin (ADD1) Antibody

20-abx001340
  • EUR 411.00
  • EUR 592.00
  • EUR 182.00
  • EUR 314.00
  • 100 ul
  • 200 ul
  • 20 ul
  • 50 ul
  • Shipped within 5-10 working days.

anti-ADD1 (Ab-726)

LF-PA20007 100 ul
EUR 334
Description: Rabbit polyclonal to ADD1

anti-ADD1 (Phospho-Ser726)

LF-PA20008 100 ul
EUR 354
Description: Rabbit polyclonal to ADD1 (Phospho-Ser726)

Recombinant Adducin 1 (ADD1)

4-RPC280Hu01
  • EUR 445.86
  • EUR 222.00
  • EUR 1396.96
  • EUR 532.32
  • EUR 964.64
  • EUR 361.00
  • EUR 3342.40
  • 100 ug
  • 10ug
  • 1 mg
  • 200 ug
  • 500 ug
  • 50ug
  • 5 mg
  • Uniprot ID: P35611
  • Buffer composition: PBS, pH 7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
  • Form: Freeze-dried powder
  • Predicted Molecular Mass (KD): 28.7kDa
  • Isoelectric Point: Inquire
Description: Recombinant Human Adducin 1 expressed in: E.coli

Recombinant Adducin 1 (ADD1)

4-RPC280Mu01
  • EUR 472.74
  • EUR 229.00
  • EUR 1497.76
  • EUR 565.92
  • EUR 1031.84
  • EUR 379.00
  • EUR 3594.40
  • 100 ug
  • 10ug
  • 1 mg
  • 200 ug
  • 500 ug
  • 50ug
  • 5 mg
  • Uniprot ID: Q9QYC0
  • Buffer composition: PBS, pH 7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
  • Form: Freeze-dried powder
  • Predicted Molecular Mass (KD): 23.0kDa
  • Isoelectric Point: Inquire
Description: Recombinant Mouse Adducin 1 expressed in: E.coli

ADD1 Recombinant Protein (Human)

RP000580 100 ug Ask for price

ADD1 Recombinant Protein (Mouse)

RP114476 100 ug Ask for price

ADD1 Recombinant Protein (Mouse)

RP114479 100 ug Ask for price

ADD1 Recombinant Protein (Mouse)

RP114482 100 ug Ask for price

ADD1 Recombinant Protein (Rat)

RP189308 100 ug Ask for price

Phospho-ADD1-S726 Rabbit pAb

AP0196-100ul 100 ul
EUR 384

Phospho-ADD1-S726 Rabbit pAb

AP0196-200ul 200 ul
EUR 554

Phospho-ADD1-S726 Rabbit pAb

AP0196-20ul 20 ul Ask for price

Phospho-ADD1-S726 Rabbit pAb

AP0196-50ul 50 ul
EUR 265

Anti-ADD1 (Ab-726) Antibody

A01575 100ul
EUR 397
Description: Rabbit Polyclonal ADD1 (Ab-726) Antibody. Validated in IF, IHC, WB and tested in Human, Mouse, Rat.

Human Adducin 1 (ADD1) Protein

20-abx168875
  • EUR 620.00
  • EUR 272.00
  • EUR 1887.00
  • EUR 746.00
  • EUR 453.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-7 working days.

Mouse Adducin 1 (ADD1) Protein

20-abx168876
  • EUR 662.00
  • EUR 272.00
  • EUR 2026.00
  • EUR 787.00
  • EUR 481.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-7 working days.

Polyclonal ADD1 (Ab-726) Antibody

APR14814G 0.1ml
EUR 484
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human ADD1 (Ab-726) . This antibody is tested and proven to work in the following applications:

Monoclonal ADD1 Antibody, Clone: 5D4H1

APR14815G 0.1ml
EUR 528
Description: A Monoclonal antibody against Human ADD1. The antibodies are raised in Mouse and are from clone 5D4H1. This antibody is applicable in WB and IHC, FC, ICC, E

Polyclonal ADD1 Antibody (aa411-460)

APR14817G 0.05ml
EUR 484
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human ADD1 (aa411-460). This antibody is tested and proven to work in the following applications:

Phospho-ADD1 (Ser726) Blocking Peptide

AF3276-BP 1mg
EUR 195

Polyclonal Phospho-ADD1-S726 Antibody

APR12826G 0.1 mg
EUR 484
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human Phospho-ADD1-S726 . This antibody is tested and proven to work in the following applications:

ADD1 (Ab-726) Conjugated Antibody

C21189 100ul
EUR 397

ADD1 / ADD2 (pS726 / 713) Antibody

20-abx329469
  • EUR 314.00
  • EUR 244.00
  • 100 ug
  • 50 ug
  • Shipped within 5-10 working days.

ADD1 / 2 Cell ELISA Kit

abx595018-96tests 96 tests
EUR 637
  • Shipped within 1-2 weeks.

Add1 ORF Vector (Rat) (pORF)

ORF063104 1.0 ug DNA
EUR 506

ADD1 ORF Vector (Human) (pORF)

ORF000194 1.0 ug DNA
EUR 95

Add1 ORF Vector (Mouse) (pORF)

ORF038160 1.0 ug DNA
EUR 506

Add1 ORF Vector (Mouse) (pORF)

ORF038161 1.0 ug DNA
EUR 506

Add1 ORF Vector (Mouse) (pORF)

ORF038162 1.0 ug DNA
EUR 506

Anti-Phospho-ADD1-(S726) antibody

STJ22007 100 µl
EUR 393
Description: Adducins are a family of cytoskeleton proteins encoded by three genes (alpha, beta, gamma). Adducin is a heterodimeric protein that consists of related subunits, which are produced from distinct genes but share a similar structure. Alpha- and beta-adducin include a protease-resistant N-terminal region and a protease-sensitive, hydrophilic C-terminal region. Alpha- and gamma-adducins are ubiquitously expressed. In contrast, beta-adducin is expressed at high levels in brain and hematopoietic tissues. Adducin binds with high affinity to Ca(2+)/calmodulin and is a substrate for protein kinases A and C. Alternative splicing results in multiple variants encoding distinct isoforms; however, not all variants have been fully described.

Phospho-ADD1/ADD2 (S726/713) Antibody

1-CSB-PA000723
  • EUR 222.00
  • EUR 195.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Liquid in PBS containing 50% glycerol, 0.5% BSA and 0.02% sodium azide. The antibody was affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogen.
Description: A polyclonal antibody against Phospho-ADD1/ADD2 (S726/713). Recognizes Phospho-ADD1/ADD2 (S726/713) from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: WB, IHC, IF, ELISA;WB:1/500-1/2000.IHC:1/100-1/300.IF:1/200-1/1000.ELISA:1/40000

Human Alpha adducin(ADD1) ELISA kit

E01A1263-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Human Alpha adducin(ADD1) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human Alpha adducin(ADD1) ELISA kit

E01A1263-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Human Alpha adducin(ADD1) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human Alpha adducin(ADD1) ELISA kit

E01A1263-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Human Alpha adducin(ADD1) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Rat Alpha adducin(ADD1) ELISA kit

E02A1263-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Rat Alpha adducin(ADD1) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Rat Alpha adducin(ADD1) ELISA kit

E02A1263-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Rat Alpha adducin(ADD1) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Rat Alpha adducin(ADD1) ELISA kit

E02A1263-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Rat Alpha adducin(ADD1) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Goat Alpha adducin(ADD1) ELISA kit

E06A1263-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Goat Alpha adducin(ADD1) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Goat Alpha adducin(ADD1) ELISA kit

E06A1263-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Goat Alpha adducin(ADD1) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Goat Alpha adducin(ADD1) ELISA kit

E06A1263-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Goat Alpha adducin(ADD1) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Mouse Alpha adducin(ADD1) ELISA kit

E03A1263-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Mouse Alpha adducin(ADD1) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Mouse Alpha adducin(ADD1) ELISA kit

E03A1263-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Mouse Alpha adducin(ADD1) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Mouse Alpha adducin(ADD1) ELISA kit

E03A1263-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Mouse Alpha adducin(ADD1) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Rabbit Alpha adducin(ADD1) ELISA kit

E04A1263-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Rabbit Alpha adducin(ADD1) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Rabbit Alpha adducin(ADD1) ELISA kit

E04A1263-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Rabbit Alpha adducin(ADD1) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Rabbit Alpha adducin(ADD1) ELISA kit

E04A1263-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Rabbit Alpha adducin(ADD1) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human Alpha adducin (ADD1) ELISA Kit

20-abx259390
  • EUR 7378.00
  • EUR 3933.00
  • EUR 911.00
  • 10 × 96 tests
  • 5 × 96 tests
  • 96 tests
  • Shipped within 5-12 working days.

Dog Alpha adducin(ADD1) ELISA kit

E08A1263-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Canine Alpha adducin(ADD1) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Dog Alpha adducin(ADD1) ELISA kit

E08A1263-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Canine Alpha adducin(ADD1) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Dog Alpha adducin(ADD1) ELISA kit

E08A1263-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Canine Alpha adducin(ADD1) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Monkey Alpha adducin(ADD1) ELISA kit

E09A1263-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Monkey Alpha adducin(ADD1) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Monkey Alpha adducin(ADD1) ELISA kit

E09A1263-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Monkey Alpha adducin(ADD1) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Monkey Alpha adducin(ADD1) ELISA kit

E09A1263-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Monkey Alpha adducin(ADD1) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Pig Alpha adducin(ADD1) ELISA kit

E07A1263-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Porcine Alpha adducin(ADD1) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Pig Alpha adducin(ADD1) ELISA kit

E07A1263-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Porcine Alpha adducin(ADD1) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Pig Alpha adducin(ADD1) ELISA kit

E07A1263-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Porcine Alpha adducin(ADD1) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Mouse Alpha- adducin, Add1 ELISA KIT

ELI-11892m 96 Tests
EUR 865

Polyclonal Add1 Antibody - N-terminal region

APR14820G 0.05mg
EUR 528
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human Add1 - N-terminal region. This antibody is tested and proven to work in the following applications:

ADD1 (Phospho-Ser726) Polyclonal Conjugated Antibody

C11182 100ul
EUR 397

Human Alpha- adducin, ADD1 ELISA KIT

ELI-34696h 96 Tests
EUR 824

Add1 sgRNA CRISPR Lentivector set (Rat)

K7605901 3 x 1.0 ug
EUR 339

Add1 sgRNA CRISPR Lentivector set (Mouse)

K4663801 3 x 1.0 ug
EUR 339

ADD1 sgRNA CRISPR Lentivector set (Human)

K0048601 3 x 1.0 ug
EUR 339

Adducin 1 (ADD1) Polyclonal Antibody (Human)

4-PAC280Hu01
  • EUR 247.00
  • EUR 2510.00
  • EUR 625.00
  • EUR 310.00
  • EUR 214.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: ADD1 (Thr99~Gln328)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Adducin 1 (ADD1)

Human Adducin 1(ADD1)ELISA Kit

QY-E02116 96T
EUR 361

Guinea pig Alpha adducin(ADD1) ELISA kit

E05A1263-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Guinea pig Alpha adducin(ADD1) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Guinea pig Alpha adducin(ADD1) ELISA kit

E05A1263-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Guinea pig Alpha adducin(ADD1) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Guinea pig Alpha adducin(ADD1) ELISA kit

E05A1263-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Guinea pig Alpha adducin(ADD1) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

ADD1/2 Colorimetric Cell-Based ELISA Kit

EKC1016 100ul
EUR 572

Monoclonal ADD1 Antibody (monoclonal) (M01), Clone: 2C9

APR14818G 0.1mg
EUR 484
Description: A Monoclonal antibody against Human ADD1 (monoclonal) (M01). The antibodies are raised in mouse and are from clone 2C9. This antibody is applicable in WB and IHC, E

Adducin 1 Phospho-Thr445 (ADD1 pT445) Antibody

20-abx326604
  • EUR 314.00
  • EUR 244.00
  • 100 ug
  • 50 ug
  • Shipped within 5-10 working days.

Adducin 1 Phospho-Ser726 (ADD1 pS726) Antibody

abx333179-100ul 100 ul
EUR 467
  • Shipped within 5-10 working days.

Add1 sgRNA CRISPR Lentivector (Rat) (Target 1)

K7605902 1.0 ug DNA
EUR 154

Add1 sgRNA CRISPR Lentivector (Rat) (Target 2)

K7605903 1.0 ug DNA
EUR 154

Add1 sgRNA CRISPR Lentivector (Rat) (Target 3)

K7605904 1.0 ug DNA
EUR 154

Add1 sgRNA CRISPR Lentivector (Mouse) (Target 1)

K4663802 1.0 ug DNA
EUR 154

Add1 sgRNA CRISPR Lentivector (Mouse) (Target 2)

K4663803 1.0 ug DNA
EUR 154

Add1 sgRNA CRISPR Lentivector (Mouse) (Target 3)

K4663804 1.0 ug DNA
EUR 154

ADD1 sgRNA CRISPR Lentivector (Human) (Target 1)

K0048602 1.0 ug DNA
EUR 154

ADD1 sgRNA CRISPR Lentivector (Human) (Target 2)

K0048603 1.0 ug DNA
EUR 154

ADD1 sgRNA CRISPR Lentivector (Human) (Target 3)

K0048604 1.0 ug DNA
EUR 154

Adducin 1 (ADD1) Polyclonal Antibody (Human), APC

4-PAC280Hu01-APC
  • EUR 345.00
  • EUR 3275.00
  • EUR 912.00
  • EUR 440.00
  • EUR 219.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: ADD1 (Thr99~Gln328)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Adducin 1 (ADD1). This antibody is labeled with APC.

Adducin 1 (ADD1) Polyclonal Antibody (Human), Biotinylated

4-PAC280Hu01-Biotin
  • EUR 311.00
  • EUR 2460.00
  • EUR 727.00
  • EUR 381.00
  • EUR 219.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: ADD1 (Thr99~Gln328)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Adducin 1 (ADD1). This antibody is labeled with Biotin.

Adducin 1 (ADD1) Polyclonal Antibody (Human), Cy3

4-PAC280Hu01-Cy3
  • EUR 419.00
  • EUR 4325.00
  • EUR 1175.00
  • EUR 545.00
  • EUR 251.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: ADD1 (Thr99~Gln328)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Adducin 1 (ADD1). This antibody is labeled with Cy3.

Adducin 1 (ADD1) Polyclonal Antibody (Human), FITC

4-PAC280Hu01-FITC
  • EUR 296.00
  • EUR 2640.00
  • EUR 750.00
  • EUR 372.00
  • EUR 195.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: ADD1 (Thr99~Gln328)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Adducin 1 (ADD1). This antibody is labeled with FITC.

Adducin 1 (ADD1) Polyclonal Antibody (Human), HRP

4-PAC280Hu01-HRP
  • EUR 316.00
  • EUR 2855.00
  • EUR 807.00
  • EUR 398.00
  • EUR 206.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: ADD1 (Thr99~Gln328)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Adducin 1 (ADD1). This antibody is labeled with HRP.

Adducin 1 (ADD1) Polyclonal Antibody (Human), PE

4-PAC280Hu01-PE
  • EUR 296.00
  • EUR 2640.00
  • EUR 750.00
  • EUR 372.00
  • EUR 195.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: ADD1 (Thr99~Gln328)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Adducin 1 (ADD1). This antibody is labeled with PE.

Adducin 1 (ADD1) Polyclonal Antibody (Human, Mouse)

4-PAC280Mu01
  • EUR 251.00
  • EUR 2576.00
  • EUR 640.00
  • EUR 316.00
  • EUR 215.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: ADD1 (Gly388~Gly560)
  • Buffer composition: PBS, pH7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
Description: A Rabbit polyclonal antibody against Human, Mouse Adducin 1 (ADD1)

ADD1 Protein Vector (Mouse) (pPB-C-His)

PV152638 500 ng
EUR 603

ADD1 Protein Vector (Mouse) (pPB-N-His)

PV152639 500 ng
EUR 603

ADD1 Protein Vector (Mouse) (pPM-C-HA)

PV152640 500 ng
EUR 603

ADD1 Protein Vector (Mouse) (pPM-C-His)

PV152641 500 ng
EUR 603

ADD1 Protein Vector (Mouse) (pPB-C-His)

PV152642 500 ng
EUR 1065

ADD1 Protein Vector (Mouse) (pPB-N-His)

PV152643 500 ng
EUR 1065

ADD1 Protein Vector (Mouse) (pPM-C-HA)

PV152644 500 ng
EUR 1065

ADD1 Protein Vector (Mouse) (pPM-C-His)

PV152645 500 ng
EUR 1065

ADD1 Protein Vector (Mouse) (pPB-C-His)

PV152646 500 ng
EUR 603

ADD1 Protein Vector (Mouse) (pPB-N-His)

PV152647 500 ng
EUR 603

ADD1 Protein Vector (Mouse) (pPM-C-HA)

PV152648 500 ng
EUR 603

ADD1 Protein Vector (Mouse) (pPM-C-His)

PV152649 500 ng
EUR 603

ADD1 Protein Vector (Rat) (pPB-C-His)

PV252414 500 ng
EUR 1166

ADD1 Protein Vector (Rat) (pPB-N-His)

PV252415 500 ng
EUR 1166

ADD1 Protein Vector (Rat) (pPM-C-HA)

PV252416 500 ng
EUR 1166

ADD1 Protein Vector (Rat) (pPM-C-His)

PV252417 500 ng
EUR 1166

ADD1 Protein Vector (Human) (pPB-His-MBP)

PV320050 500 ng
EUR 329

ADD1 Protein Vector (Human) (pPB-His-GST)

PV320051 500 ng
EUR 329

ADD1 Protein Vector (Human) (pPB-C-His)

PV000773 500 ng
EUR 329

ADD1 Protein Vector (Human) (pPB-N-His)

PV000774 500 ng
EUR 329

ADD1 Protein Vector (Human) (pPM-C-HA)

PV000775 500 ng
EUR 329

ADD1 Protein Vector (Human) (pPM-C-His)

PV000776 500 ng
EUR 329

Add1 3'UTR Luciferase Stable Cell Line

TU101434 1.0 ml Ask for price

Add1 3'UTR GFP Stable Cell Line

TU151434 1.0 ml Ask for price

Add1 3'UTR Luciferase Stable Cell Line

TU200315 1.0 ml Ask for price

Add1 3'UTR GFP Stable Cell Line

TU250315 1.0 ml Ask for price

ADD1 3'UTR GFP Stable Cell Line

TU050366 1.0 ml
EUR 2333

The presence of additional cytogenetic abnormalities did not modify the outcome of patients with favorable cytogenetics. Subgroup analysis demonstrated that the three cytogenetically defined prognostic groups retained their predictive value in the context of secondary as well as de novo AML, within the pediatric age group and furthermore were found to be a key determinant of outcome from autologous or allogeneic bone marrow transplantation (BMT) in first CR. This study highlights the importance of diagnostic cytogenetics as an independent prognostic factor in AML, providing the framework for a stratified treatment approach of this disease, which has been adopted in the current MRC AML 12 trial.

Back to top