The importance of diagnostic cytogenetics on outcome in AML: analysis of 1,612 patients entered into the MRC AML 10 trial. The Medical Research Council Adult and Children’s Leukaemia Working Parties.

Cytogenetics is considered one of the most valuable prognostic determinants in acute myeloid leukemia (AML). However, many studies on which this assertion is based were limited by relatively small sample sizes or varying treatment approach, leading to conflicting data regarding the prognostic implications of specific cytogenetic abnormalities. The Medical Research Council (MRC) AML 10 trial, which included children and adults up to 55 years of age, not only affords the opportunity to determine the independent prognostic significance of pretreatment cytogenetics in the context of large patient groups receiving comparable therapy, but also to address their impact on the outcome of subsequent transplantation procedures performed in first complete remission (CR).

On the basis of response to induction treatment, relapse risk, and overall survival, three prognostic groups could be defined by cytogenetic abnormalities detected at presentation in comparison with the outcome of patients with normal karyotype.

AML associated with t(8;21), t(15;17) or inv(16) predicted a relatively favorable outcome. Whereas in patients lacking these favorable changes, the presence of a complex karyotype, -5, del(5q), -7, or abnormalities of 3q defined a group with relatively poor prognosis. The remaining group of patients including those with 11q23 abnormalities, +8, +21, +22, del(9q), del(7q) or other miscellaneous structural or numerical defects not encompassed by the favorable or adverse risk groups were found to have an intermediate prognosis.

ADD1 siRNA
20-abx900187	Abbexa	EUR 551.00 EUR 732.00	15 nmol 30 nmol
Shipped within 5-10 working days.

ADD1 siRNA
20-abx906840	Abbexa	EUR 551.00 EUR 732.00	15 nmol 30 nmol
Shipped within 5-10 working days.

ADD1 siRNA
20-abx906841	Abbexa	EUR 551.00 EUR 732.00	15 nmol 30 nmol
Shipped within 5-10 working days.

ADD1 Antibody
ABF6276	Lifescience Market	100 ug	EUR 438

ADD1 antibody
70R-51430	Fitzgerald	100 ul	EUR 244
Description: Purified Polyclonal ADD1 antibody

ADD1 antibody
70R-30557	Fitzgerald	100 ug	EUR 327
Description: Rabbit polyclonal ADD1 antibody

ADD1 antibody
70R-31329	Fitzgerald	100 ug	EUR 327
Description: Rabbit polyclonal ADD1 antibody

ADD1 Antibody
ABD6484	Lifescience Market	100 ug	EUR 438

ADD1 Antibody
32329-100ul	SAB	100ul	EUR 252

ADD1 antibody
20R-2029	Fitzgerald	50 ug	EUR 281
Description: Rabbit polyclonal ADD1 antibody

ADD1 antibody
20R-2353	Fitzgerald	50 ug	EUR 281
Description: Rabbit polyclonal ADD1 antibody

ADD1 antibody
70R-15595	Fitzgerald	50 ul	EUR 435
Description: Rabbit polyclonal ADD1 antibody

ADD1 Antibody
DF6484	Affbiotech	200ul	EUR 304
Description: ADD1 Antibody detects endogenous levels of total ADD1.

ADD1 Antibody
1-CSB-PA985327	Cusabio	EUR 317.00 EUR 244.00	100ul 50ul
Form: Liquid Buffer: -20°C, pH7.4 PBS, 0.05% NaN3, 40% Glycerol Antigen affinity purification
Description: A polyclonal antibody against ADD1. Recognizes ADD1 from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, IHC;ELISA:1:500-1:5000, IHC:1:50-1:200

ADD1 Antibody
1-CSB-PA001348ESR1HU	Cusabio	EUR 222.00 EUR 335.00	100ul 50ul
Form: Liquid Buffer: PBS with 0.02% sodium azide, 50% glycerol, pH7.3. Antigen Affinity Purified
Description: A polyclonal antibody against ADD1. Recognizes ADD1 from Human. This antibody is Unconjugated. Tested in the following application: ELISA, IHC; Recommended dilution: IHC:1:20-1:200

ADD1 Antibody
1-CSB-PA001348GA01HU	Cusabio	EUR 597.00 EUR 333.00	150ul 50ul
Form: Liquid Buffer: PBS with 0.1% Sodium Azide, 50% Glycerol, pH 7.3. -20℃, Avoid freeze / thaw cycles. Antigen Affinity Purified
Description: A polyclonal antibody against ADD1. Recognizes ADD1 from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC

ADD1 Antibody
1-CSB-PA006900	Cusabio	EUR 222.00 EUR 195.00	100ug 50ug
Form: Liquid Buffer: Liquid in PBS containing 50% glycerol, 0.5% BSA and 0.02% sodium azide. The antibody was affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogen.
Description: A polyclonal antibody against ADD1. Recognizes ADD1 from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: IHC, IF, ELISA;IHC:1/100-1/300.IF:1/200-1/1000.ELISA:1/10000

ADD1 Antibody
1-CSB-PA274173	Cusabio	EUR 317.00 EUR 244.00	100ul 50ul
Form: Liquid Buffer: -20°C, pH7.4 PBS, 0.05% NaN3, 40% Glycerol Antigen affinity purification
Description: A polyclonal antibody against ADD1. Recognizes ADD1 from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, IHC;ELISA:1:500-1:5000, IHC:1:50-1:200

ADD1 Blocking Peptide
AF6276-BP	Affbiotech	1mg	EUR 195

Polyclonal ADD1 Antibody
APR14816G	Leading Biology	0.05ml	EUR 484
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human ADD1 . This antibody is tested and proven to work in the following applications:

ADD1 Polyclonal Antibody
ES4673-100ul	ELK Biotech	100ul	EUR 279
Description: A Rabbit Polyclonal antibody against ADD1 from Human/Mouse/Rat. This antibody is tested and validated for IHC, IF, WB, ELISA

ADD1 Polyclonal Antibody
ES4673-50ul	ELK Biotech	50ul	EUR 207
Description: A Rabbit Polyclonal antibody against ADD1 from Human/Mouse/Rat. This antibody is tested and validated for IHC, IF, WB, ELISA

ADD1 (pS726) Antibody
20-abx000248	Abbexa	EUR 495.00 EUR 704.00 EUR 356.00	100 ul 200 ul 50 ul
Shipped within 5-10 working days.

ADD1 (pS726) Antibody
abx010351-100ug	Abbexa	100 ug	EUR 439
Shipped within 5-10 working days.

ADD1 Polyclonal Antibody
ABP53674-003ml	Abbkine	0.03ml	EUR 158
Immunogen information: Synthesized peptide derived from human Adducin ? around the non-phosphorylation site of T445 Applications tips:
Description: A polyclonal antibody for detection of ADD1 from Human, Mouse, Rat. This ADD1 antibody is for IHC-P, IF, ELISA. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from human Adducin ? around the non-phosphorylation site of T445

ADD1 Polyclonal Antibody
ABP53674-01ml	Abbkine	0.1ml	EUR 289
Immunogen information: Synthesized peptide derived from human Adducin ? around the non-phosphorylation site of T445 Applications tips:
Description: A polyclonal antibody for detection of ADD1 from Human, Mouse, Rat. This ADD1 antibody is for IHC-P, IF, ELISA. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from human Adducin ? around the non-phosphorylation site of T445

ADD1 Polyclonal Antibody
ABP53674-02ml	Abbkine	0.2ml	EUR 414
Immunogen information: Synthesized peptide derived from human Adducin ? around the non-phosphorylation site of T445 Applications tips:
Description: A polyclonal antibody for detection of ADD1 from Human, Mouse, Rat. This ADD1 antibody is for IHC-P, IF, ELISA. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from human Adducin ? around the non-phosphorylation site of T445

ADD1 / ADD2 Antibody
20-abx329729	Abbexa	EUR 314.00 EUR 244.00	100 ug 50 ug
Shipped within 5-10 working days.

ADD1 antibody (Ser726)
70R-37256	Fitzgerald	100 ug	EUR 349
Description: Rabbit Polyclonal ADD1 antibody (Ser726)

ADD1 antibody (Ser726)
70R-30556	Fitzgerald	100 ug	EUR 327
Description: Rabbit polyclonal ADD1 antibody (Ser726)

ADD1 antibody (Thr445)
70R-31328	Fitzgerald	100 ug	EUR 327
Description: Rabbit polyclonal ADD1 antibody (Thr445)

Anti-ADD1 Antibody
A1744-100	Biovision		EUR 479

ADD1 Rabbit pAb
A1592-100ul	Abclonal	100 ul	EUR 308

ADD1 Rabbit pAb
A1592-200ul	Abclonal	200 ul	EUR 459

ADD1 Rabbit pAb
A1592-20ul	Abclonal	20 ul	EUR 183

ADD1 Rabbit pAb
A1592-50ul	Abclonal	50 ul	EUR 223

ADD1 Blocking Peptide
DF6484-BP	Affbiotech	1mg	EUR 195

ADD1/ADD2 Antibody
1-CSB-PA000825	Cusabio	EUR 222.00 EUR 195.00	100ug 50ug
Form: Liquid Buffer: Liquid in PBS containing 50% glycerol, 0.5% BSA and 0.02% sodium azide. The antibody was affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogen.
Description: A polyclonal antibody against ADD1/ADD2. Recognizes ADD1/ADD2 from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: WB, IHC, IP, IF, ELISA;WB:1/500-1/2000.IHC:1/100-1/300.IP:2-5ug/mglysate.IF:1/200-1/1000.ELISA:1/40000

ADD1 cloning plasmid
CSB-CL001348HU-10ug	Cusabio	10ug	EUR 233
Formulation: 10 μg plasmid + 200μl Glycerol Length: 1203 Sequence: atgaatggtgattctcgtgctgcggtggtgacctcaccacccccgaccacagcccctcacaaggagaggtacttcgaccgagtagatgagaacaacccagagtacttgagggagaggaacatggcaccagaccttcgccaggacttcaacatgatggagcaaaagaagagggtgt Show more
Description: A cloning plasmid for the ADD1 gene.

Anti-ADD1 antibody
STJ91489	St John's Laboratory	200 µl	EUR 197
Description: Rabbit polyclonal to ADD1.

Anti-ADD1 antibody
STJ22515	St John's Laboratory	100 µl	EUR 277
Description: Adducins are a family of cytoskeleton proteins encoded by three genes (alpha, beta, gamma). Adducin is a heterodimeric protein that consists of related subunits, which are produced from distinct genes but share a similar structure. Alpha- and beta-adducin include a protease-resistant N-terminal region and a protease-sensitive, hydrophilic C-terminal region. Alpha- and gamma-adducins are ubiquitously expressed. In contrast, beta-adducin is expressed at high levels in brain and hematopoietic tissues. Adducin binds with high affinity to Ca(2+)/calmodulin and is a substrate for protein kinases A and C. Alternative splicing results in multiple variants encoding distinct isoforms; however, not all variants have been fully described.

Phospho-ADD1 (Ser726) Antibody
AF3276	Affbiotech	200ul	EUR 304
Description: Phospho-ADD1 (Ser726) Antibody detects endogenous levels of ADD1 only when phosphorylated at Serine 726.

Polyclonal ADD1 Antibody (S726)
APG03120G	Leading Biology	0.1 mg	EUR 484
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human ADD1 (S726). This antibody is tested and proven to work in the following applications:

Polyclonal ADD1 Antibody (Ser726)
APR14819G	Leading Biology	0.05mg	EUR 484
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human ADD1 (Ser726). This antibody is tested and proven to work in the following applications:

Rat ADD1 shRNA Plasmid
20-abx984360	Abbexa	EUR 801.00 EUR 1121.00	150 µg 300 µg
Shipped within 15-20 working days.

Adducin 1 (ADD1) Antibody
20-abx130606	Abbexa	EUR 439.00 EUR 133.00 EUR 1233.00 EUR 592.00 EUR 328.00	100 ug 10 ug 1 mg 200 ug 50 ug
Shipped within 5-7 working days.

Adducin 1 (ADD1) Antibody
20-abx130607	Abbexa	EUR 425.00 EUR 133.00 EUR 1205.00 EUR 578.00 EUR 328.00	100 ug 10 ug 1 mg 200 ug 50 ug
Shipped within 5-7 working days.

Adducin 1 (ADD1) Antibody
20-abx110834	Abbexa	EUR 732.00 EUR 398.00	150 ul 50 ul
Shipped within 5-10 working days.

Alpha-Adducin (ADD1) Antibody
20-abx001340	Abbexa	EUR 411.00 EUR 592.00 EUR 182.00 EUR 314.00	100 ul 200 ul 20 ul 50 ul
Shipped within 5-10 working days.

Alpha-Adducin (ADD1) Antibody
abx148001-100ug	Abbexa	100 ug	EUR 439
Shipped within 5-10 working days.

Alpha-Adducin (ADD1) Antibody
abx010352-100ug	Abbexa	100 ug	EUR 439
Shipped within 5-10 working days.

ADD1 (Phospho-Ser726) Antibody
20-abx012401	Abbexa	EUR 314.00 EUR 98.00 EUR 398.00 EUR 495.00	100 ug 10 ug 200 ug 300 µg
Shipped within 5-10 working days.

Phospho- ADD1 (Ser726) Antibody
ABF3276	Lifescience Market	100 ug	EUR 438

Alpha-Adducin (ADD1) Antibody
20-abx320155	Abbexa	EUR 300.00 EUR 244.00	100 ul 50 ul
Shipped within 5-10 working days.

Adducin 1 (ADD1) Antibody
20-abx326704	Abbexa	EUR 314.00 EUR 244.00	100 ug 50 ug
Shipped within 5-10 working days.

Alpha-Adducin (ADD1) Antibody
abx224142-100ug	Abbexa	100 ug	EUR 411
Shipped within 5-10 working days.

Adducin 1 (ADD1) Antibody
abx332016-100ul	Abbexa	100 ul	EUR 425
Shipped within 5-10 working days.

Adducin 1 (ADD1) Antibody
abx332311-100ul	Abbexa	100 ul	EUR 425
Shipped within 5-10 working days.

Adducin 1 (ADD1) Antibody
20-abx242435	Abbexa	EUR 411.00 EUR 300.00	100 ul 50 ul
Shipped within 5-10 working days.

Adducin 1 (ADD1) Antibody
20-abx242436	Abbexa	EUR 411.00 EUR 300.00	100 ul 50 ul
Shipped within 5-10 working days.

Human ADD1 shRNA Plasmid
20-abx950080	Abbexa	EUR 801.00 EUR 1121.00	150 µg 300 µg
Shipped within 15-20 working days.

ADD1 (Phospho-Ser726) Antibody
11182-100ul	SAB	100ul	EUR 252

ADD1 (Phospho-Ser726) Antibody
11182-50ul	SAB	50ul	EUR 187

ADD1 (Ab-726) Antibody
33115-100ul	SAB	100ul	EUR 252

ADD1 (Ab-726) Antibody
33115-50ul	SAB	50ul	EUR 187

ADD1 (Ab-726) Antibody
21189-100ul	SAB	100ul	EUR 252

ADD1 (Ab-726) Antibody
21189-50ul	SAB	50ul	EUR 187

Mouse ADD1 shRNA Plasmid
20-abx969047	Abbexa	EUR 801.00 EUR 1121.00	150 µg 300 µg
Shipped within 15-20 working days.

Phospho-ADD1 (T445) Antibody
1-CSB-PA006899	Cusabio	EUR 222.00 EUR 195.00	100ug 50ug
Form: Liquid Buffer: Liquid in PBS containing 50% glycerol, 0.5% BSA and 0.02% sodium azide. The antibody was affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogen.
Description: A polyclonal antibody against Phospho-ADD1 (T445). Recognizes Phospho-ADD1 (T445) from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: IHC, ELISA;IHC:1/100-1/300.ELISA:1/5000

ADD1 (Ab-726) Antibody
CSB-PA592573-	Cusabio		EUR 335
Form: liquid Buffer: Supplied at 1.0mg/mL in phosphate buffered saline (without Mg2+ and Ca2+), pH 7.4, 150mM NaCl, 0.02% sodium azide and 50% glycerol. Antibodies were produced by immunizing rabbits with synthetic peptide and KLH conjugates. Antibo Show more
Description: A polyclonal antibody against ADD1 (Ab-726). Recognizes ADD1 (Ab-726) from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC, IF;WB:1:500-1:1000, IHC:1:50-1:200, IF:1:100-1:200

ADD1 (Ab-726) Antibody
CSB-PA592573-100ul	Cusabio	100ul	EUR 316
Form: liquid Buffer: Supplied at 1.0mg/mL in phosphate buffered saline (without Mg2+ and Ca2+), pH 7.4, 150mM NaCl, 0.02% sodium azide and 50% glycerol. Antibodies were produced by immunizing rabbits with synthetic peptide and KLH conjugates. Antibo Show more
Description: A polyclonal antibody against ADD1 (Ab-726). Recognizes ADD1 (Ab-726) from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC, IF;WB:1:500-1:1000, IHC:1:50-1:200, IF:1:100-1:200

Phospho-ADD1 (Ser726) Antibody
CSB-PA557123-	Cusabio		EUR 335
Form: liquid Buffer: Supplied at 1.0mg/mL in phosphate buffered saline (without Mg2+ and Ca2+), pH 7.4, 150mM NaCl, 0.02% sodium azide and 50% glycerol. Antibodies were produced by immunizing rabbits with synthetic phosphopeptide and KLH conjugates. Show more
Description: A polyclonal antibody against Phospho-ADD1 (Ser726). Recognizes Phospho-ADD1 (Ser726) from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC, IF;WB:1:500-1:1000, IHC:1:50-1:100, IF:1:100-1:200

Phospho-ADD1 (Ser726) Antibody
CSB-PA557123-100ul	Cusabio	100ul	EUR 362
Form: liquid Buffer: Supplied at 1.0mg/mL in phosphate buffered saline (without Mg2+ and Ca2+), pH 7.4, 150mM NaCl, 0.02% sodium azide and 50% glycerol. Antibodies were produced by immunizing rabbits with synthetic phosphopeptide and KLH conjugates. Show more
Description: A polyclonal antibody against Phospho-ADD1 (Ser726). Recognizes Phospho-ADD1 (Ser726) from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC, IF;WB:1:500-1:1000, IHC:1:50-1:100, IF:1:100-1:200

ADD1 (Ab-726) Antibody
CSB-PA570375-	Cusabio		EUR 335
Form: liquid Buffer: Rabbit IgG in phosphate buffered saline (without Mg2+ and Ca2+), pH 7.4, 150mM NaCl, 0.02% sodium azide and 50% glycerol. The antibody was affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific Show more
Description: A polyclonal antibody against ADD1 (Ab-726). Recognizes ADD1 (Ab-726) from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC, IF;WB:1:500-1:3000, IHC:1:50-1:100, IF:1:100-1:500

ADD1 (Ab-726) Antibody
CSB-PA570375-100ul	Cusabio	100ul	EUR 316
Form: liquid Buffer: Rabbit IgG in phosphate buffered saline (without Mg2+ and Ca2+), pH 7.4, 150mM NaCl, 0.02% sodium azide and 50% glycerol. The antibody was affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific Show more
Description: A polyclonal antibody against ADD1 (Ab-726). Recognizes ADD1 (Ab-726) from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC, IF;WB:1:500-1:3000, IHC:1:50-1:100, IF:1:100-1:500

anti-ADD1 (Ab-726)
LF-PA20007	Abfrontier	100 ul	EUR 334
Description: Rabbit polyclonal to ADD1

anti-ADD1 (Phospho-Ser726)
LF-PA20008	Abfrontier	100 ul	EUR 354
Description: Rabbit polyclonal to ADD1 (Phospho-Ser726)

ADD1 Recombinant Protein (Human)
RP000580	ABM	100 ug	Ask for price

Recombinant Adducin 1 (ADD1)
4-RPC280Hu01	Cloud-Clone	EUR 445.86 EUR 222.00 EUR 1396.96 EUR 532.32 EUR 964.64 EUR 361.00 EUR 3342.40	100 ug 10ug 1 mg 200 ug 500 ug 50ug 5 mg
Uniprot ID: P35611 Buffer composition: PBS, pH 7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300. Form: Freeze-dried powder Predicted Molecular Mass (KD): 28.7kDa Isoelectric Point: Inquire
Description: Recombinant Human Adducin 1 expressed in: E.coli

Recombinant Adducin 1 (ADD1)
4-RPC280Mu01	Cloud-Clone	EUR 472.74 EUR 229.00 EUR 1497.76 EUR 565.92 EUR 1031.84 EUR 379.00 EUR 3594.40	100 ug 10ug 1 mg 200 ug 500 ug 50ug 5 mg
Uniprot ID: Q9QYC0 Buffer composition: PBS, pH 7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300. Form: Freeze-dried powder Predicted Molecular Mass (KD): 23.0kDa Isoelectric Point: Inquire
Description: Recombinant Mouse Adducin 1 expressed in: E.coli

ADD1 Recombinant Protein (Rat)
RP189308	ABM	100 ug	Ask for price

ADD1 Recombinant Protein (Mouse)
RP114476	ABM	100 ug	Ask for price

ADD1 Recombinant Protein (Mouse)
RP114479	ABM	100 ug	Ask for price

ADD1 Recombinant Protein (Mouse)
RP114482	ABM	100 ug	Ask for price

Phospho-ADD1 (Ser726) Blocking Peptide
AF3276-BP	Affbiotech	1mg	EUR 195

Phospho-ADD1-S726 Rabbit pAb
AP0196-100ul	Abclonal	100 ul	EUR 384

Phospho-ADD1-S726 Rabbit pAb
AP0196-200ul	Abclonal	200 ul	EUR 554

Phospho-ADD1-S726 Rabbit pAb
AP0196-20ul	Abclonal	20 ul	Ask for price

Phospho-ADD1-S726 Rabbit pAb
AP0196-50ul	Abclonal	50 ul	EUR 265

ADD1 / 2 Cell ELISA Kit
abx595018-96tests	Abbexa	96 tests	EUR 637
Shipped within 1-2 weeks.

Polyclonal Phospho-ADD1-S726 Antibody
APR12826G	Leading Biology	0.1 mg	EUR 484
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human Phospho-ADD1-S726 . This antibody is tested and proven to work in the following applications:

Polyclonal ADD1 (Ab-726) Antibody
APR14814G	Leading Biology	0.1ml	EUR 484
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human ADD1 (Ab-726) . This antibody is tested and proven to work in the following applications:

Monoclonal ADD1 Antibody, Clone: 5D4H1
APR14815G	Leading Biology	0.1ml	EUR 528
Description: A Monoclonal antibody against Human ADD1. The antibodies are raised in Mouse and are from clone 5D4H1. This antibody is applicable in WB and IHC, FC, ICC, E

Polyclonal ADD1 Antibody (aa411-460)
APR14817G	Leading Biology	0.05ml	EUR 484
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human ADD1 (aa411-460). This antibody is tested and proven to work in the following applications:

ADD1 (Ab-726) Conjugated Antibody
C21189	SAB	100ul	EUR 397

Human Adducin 1 (ADD1) Protein
20-abx168875	Abbexa	EUR 620.00 EUR 272.00 EUR 1887.00 EUR 746.00 EUR 453.00	100 ug 10 ug 1 mg 200 ug 50 ug
Shipped within 5-7 working days.

Mouse Adducin 1 (ADD1) Protein
20-abx168876	Abbexa	EUR 662.00 EUR 272.00 EUR 2026.00 EUR 787.00 EUR 481.00	100 ug 10 ug 1 mg 200 ug 50 ug
Shipped within 5-7 working days.

ADD1 / ADD2 (pS726 / 713) Antibody
20-abx329469	Abbexa	EUR 314.00 EUR 244.00	100 ug 50 ug
Shipped within 5-10 working days.

Anti-ADD1 (Ab-726) Antibody
A01575	BosterBio	100ul	EUR 397
Description: Rabbit Polyclonal ADD1 (Ab-726) Antibody. Validated in IF, IHC, WB and tested in Human, Mouse, Rat.

ADD1 ORF Vector (Human) (pORF)
ORF000194	ABM	1.0 ug DNA	EUR 95

Add1 ORF Vector (Mouse) (pORF)
ORF038160	ABM	1.0 ug DNA	EUR 506

Add1 ORF Vector (Mouse) (pORF)
ORF038161	ABM	1.0 ug DNA	EUR 506

Add1 ORF Vector (Mouse) (pORF)
ORF038162	ABM	1.0 ug DNA	EUR 506

Add1 ORF Vector (Rat) (pORF)
ORF063104	ABM	1.0 ug DNA	EUR 506

Anti-Phospho-ADD1-(S726) antibody
STJ22007	St John's Laboratory	100 µl	EUR 393
Description: Adducins are a family of cytoskeleton proteins encoded by three genes (alpha, beta, gamma). Adducin is a heterodimeric protein that consists of related subunits, which are produced from distinct genes but share a similar structure. Alpha- and beta-adducin include a protease-resistant N-terminal region and a protease-sensitive, hydrophilic C-terminal region. Alpha- and gamma-adducins are ubiquitously expressed. In contrast, beta-adducin is expressed at high levels in brain and hematopoietic tissues. Adducin binds with high affinity to Ca(2+)/calmodulin and is a substrate for protein kinases A and C. Alternative splicing results in multiple variants encoding distinct isoforms; however, not all variants have been fully described.

Polyclonal Add1 Antibody - N-terminal region
APR14820G	Leading Biology	0.05mg	EUR 528
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human Add1 - N-terminal region. This antibody is tested and proven to work in the following applications:

ADD1 (Phospho-Ser726) Polyclonal Conjugated Antibody
C11182	SAB	100ul	EUR 397

Goat Alpha adducin(ADD1) ELISA kit
E06A1263-192T	B-Gene	192 tests	EUR 1270
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A sandwich ELISA for quantitative measurement of Goat Alpha adducin(ADD1) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Goat Alpha adducin(ADD1) ELISA kit
E06A1263-48	B-Gene	1 plate of 48 wells	EUR 520
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A sandwich ELISA for quantitative measurement of Goat Alpha adducin(ADD1) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Goat Alpha adducin(ADD1) ELISA kit
E06A1263-96	B-Gene	1 plate of 96 wells	EUR 685
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A sandwich ELISA for quantitative measurement of Goat Alpha adducin(ADD1) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Rat Alpha adducin(ADD1) ELISA kit
E02A1263-192T	B-Gene	192 tests	EUR 1270
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A sandwich ELISA for quantitative measurement of Rat Alpha adducin(ADD1) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Rat Alpha adducin(ADD1) ELISA kit
E02A1263-48	B-Gene	1 plate of 48 wells	EUR 520
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A sandwich ELISA for quantitative measurement of Rat Alpha adducin(ADD1) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Rat Alpha adducin(ADD1) ELISA kit
E02A1263-96	B-Gene	1 plate of 96 wells	EUR 685
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A sandwich ELISA for quantitative measurement of Rat Alpha adducin(ADD1) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Mouse Alpha adducin(ADD1) ELISA kit
E03A1263-192T	B-Gene	192 tests	EUR 1270
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A sandwich ELISA for quantitative measurement of Mouse Alpha adducin(ADD1) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Mouse Alpha adducin(ADD1) ELISA kit
E03A1263-48	B-Gene	1 plate of 48 wells	EUR 520
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A sandwich ELISA for quantitative measurement of Mouse Alpha adducin(ADD1) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Mouse Alpha adducin(ADD1) ELISA kit
E03A1263-96	B-Gene	1 plate of 96 wells	EUR 685
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A sandwich ELISA for quantitative measurement of Mouse Alpha adducin(ADD1) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Rabbit Alpha adducin(ADD1) ELISA kit
E04A1263-192T	B-Gene	192 tests	EUR 1270
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A sandwich ELISA for quantitative measurement of Rabbit Alpha adducin(ADD1) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Rabbit Alpha adducin(ADD1) ELISA kit
E04A1263-48	B-Gene	1 plate of 48 wells	EUR 520
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A sandwich ELISA for quantitative measurement of Rabbit Alpha adducin(ADD1) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Rabbit Alpha adducin(ADD1) ELISA kit
E04A1263-96	B-Gene	1 plate of 96 wells	EUR 685
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A sandwich ELISA for quantitative measurement of Rabbit Alpha adducin(ADD1) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human Alpha adducin(ADD1) ELISA kit
E01A1263-192T	B-Gene	192 tests	EUR 1270
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A sandwich ELISA for quantitative measurement of Human Alpha adducin(ADD1) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human Alpha adducin(ADD1) ELISA kit
E01A1263-48	B-Gene	1 plate of 48 wells	EUR 520
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A sandwich ELISA for quantitative measurement of Human Alpha adducin(ADD1) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human Alpha adducin(ADD1) ELISA kit
E01A1263-96	B-Gene	1 plate of 96 wells	EUR 685
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A sandwich ELISA for quantitative measurement of Human Alpha adducin(ADD1) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Dog Alpha adducin(ADD1) ELISA kit
E08A1263-192T	B-Gene	192 tests	EUR 1270
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A sandwich ELISA for quantitative measurement of Canine Alpha adducin(ADD1) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Dog Alpha adducin(ADD1) ELISA kit
E08A1263-48	B-Gene	1 plate of 48 wells	EUR 520
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A sandwich ELISA for quantitative measurement of Canine Alpha adducin(ADD1) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Dog Alpha adducin(ADD1) ELISA kit
E08A1263-96	B-Gene	1 plate of 96 wells	EUR 685
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A sandwich ELISA for quantitative measurement of Canine Alpha adducin(ADD1) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Pig Alpha adducin(ADD1) ELISA kit
E07A1263-192T	B-Gene	192 tests	EUR 1270
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A sandwich ELISA for quantitative measurement of Porcine Alpha adducin(ADD1) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Pig Alpha adducin(ADD1) ELISA kit
E07A1263-48	B-Gene	1 plate of 48 wells	EUR 520
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A sandwich ELISA for quantitative measurement of Porcine Alpha adducin(ADD1) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Pig Alpha adducin(ADD1) ELISA kit
E07A1263-96	B-Gene	1 plate of 96 wells	EUR 685
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A sandwich ELISA for quantitative measurement of Porcine Alpha adducin(ADD1) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Monkey Alpha adducin(ADD1) ELISA kit
E09A1263-192T	B-Gene	192 tests	EUR 1270
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A sandwich ELISA for quantitative measurement of Monkey Alpha adducin(ADD1) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Monkey Alpha adducin(ADD1) ELISA kit
E09A1263-48	B-Gene	1 plate of 48 wells	EUR 520
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A sandwich ELISA for quantitative measurement of Monkey Alpha adducin(ADD1) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Monkey Alpha adducin(ADD1) ELISA kit
E09A1263-96	B-Gene	1 plate of 96 wells	EUR 685
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A sandwich ELISA for quantitative measurement of Monkey Alpha adducin(ADD1) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Mouse Alpha- adducin, Add1 ELISA KIT
ELI-11892m	Lifescience Market	96 Tests	EUR 865

ADD1 sgRNA CRISPR Lentivector set (Human)
K0048601	ABM	3 x 1.0 ug	EUR 339

Human Alpha- adducin, ADD1 ELISA KIT
ELI-34696h	Lifescience Market	96 Tests	EUR 824

Human Alpha adducin (ADD1) ELISA Kit
20-abx259390	Abbexa	EUR 7378.00 EUR 3933.00 EUR 911.00	10 × 96 tests 5 × 96 tests 96 tests
Shipped within 5-12 working days.

Add1 sgRNA CRISPR Lentivector set (Mouse)
K4663801	ABM	3 x 1.0 ug	EUR 339

Phospho-ADD1/ADD2 (S726/713) Antibody
1-CSB-PA000723	Cusabio	EUR 222.00 EUR 195.00	100ug 50ug
Form: Liquid Buffer: Liquid in PBS containing 50% glycerol, 0.5% BSA and 0.02% sodium azide. The antibody was affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogen.
Description: A polyclonal antibody against Phospho-ADD1/ADD2 (S726/713). Recognizes Phospho-ADD1/ADD2 (S726/713) from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: WB, IHC, IF, ELISA;WB:1/500-1/2000.IHC:1/100-1/300.IF:1/200-1/1000.ELISA:1/40000

Add1 sgRNA CRISPR Lentivector set (Rat)
K7605901	ABM	3 x 1.0 ug	EUR 339

Adducin 1 (ADD1) Polyclonal Antibody (Human)
4-PAC280Hu01	Cloud-Clone	EUR 247.00 EUR 2510.00 EUR 625.00 EUR 310.00 EUR 214.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: ADD1 (Thr99~Gln328) Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Adducin 1 (ADD1)

Human Adducin 1(ADD1)ELISA Kit
QY-E02116	Qayee Biotechnology	96T	EUR 361

Monoclonal ADD1 Antibody (monoclonal) (M01), Clone: 2C9
APR14818G	Leading Biology	0.1mg	EUR 484
Description: A Monoclonal antibody against Human ADD1 (monoclonal) (M01). The antibodies are raised in mouse and are from clone 2C9. This antibody is applicable in WB and IHC, E

Guinea pig Alpha adducin(ADD1) ELISA kit
E05A1263-192T	B-Gene	192 tests	EUR 1270
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A sandwich ELISA for quantitative measurement of Guinea pig Alpha adducin(ADD1) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Guinea pig Alpha adducin(ADD1) ELISA kit
E05A1263-48	B-Gene	1 plate of 48 wells	EUR 520
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A sandwich ELISA for quantitative measurement of Guinea pig Alpha adducin(ADD1) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Guinea pig Alpha adducin(ADD1) ELISA kit
E05A1263-96	B-Gene	1 plate of 96 wells	EUR 685
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A sandwich ELISA for quantitative measurement of Guinea pig Alpha adducin(ADD1) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

ADD1/2 Colorimetric Cell-Based ELISA Kit
EKC1016	BosterBio	100ul	EUR 572

ADD1 sgRNA CRISPR Lentivector (Human) (Target 1)
K0048602	ABM	1.0 ug DNA	EUR 154

ADD1 sgRNA CRISPR Lentivector (Human) (Target 2)
K0048603	ABM	1.0 ug DNA	EUR 154

ADD1 sgRNA CRISPR Lentivector (Human) (Target 3)
K0048604	ABM	1.0 ug DNA	EUR 154

Adducin 1 Phospho-Thr445 (ADD1 pT445) Antibody
20-abx326604	Abbexa	EUR 314.00 EUR 244.00	100 ug 50 ug
Shipped within 5-10 working days.

Adducin 1 Phospho-Ser726 (ADD1 pS726) Antibody
abx333179-100ul	Abbexa	100 ul	EUR 467
Shipped within 5-10 working days.

Add1 sgRNA CRISPR Lentivector (Mouse) (Target 1)
K4663802	ABM	1.0 ug DNA	EUR 154

Add1 sgRNA CRISPR Lentivector (Mouse) (Target 2)
K4663803	ABM	1.0 ug DNA	EUR 154

Add1 sgRNA CRISPR Lentivector (Mouse) (Target 3)
K4663804	ABM	1.0 ug DNA	EUR 154

Add1 sgRNA CRISPR Lentivector (Rat) (Target 1)
K7605902	ABM	1.0 ug DNA	EUR 154

Add1 sgRNA CRISPR Lentivector (Rat) (Target 2)
K7605903	ABM	1.0 ug DNA	EUR 154

Add1 sgRNA CRISPR Lentivector (Rat) (Target 3)
K7605904	ABM	1.0 ug DNA	EUR 154

ADD1 Protein Vector (Human) (pPB-C-His)
PV000773	ABM	500 ng	EUR 329

ADD1 Protein Vector (Human) (pPB-N-His)
PV000774	ABM	500 ng	EUR 329

ADD1 Protein Vector (Human) (pPM-C-HA)
PV000775	ABM	500 ng	EUR 329

ADD1 Protein Vector (Human) (pPM-C-His)
PV000776	ABM	500 ng	EUR 329

Adducin 1 (ADD1) Polyclonal Antibody (Human), APC
4-PAC280Hu01-APC	Cloud-Clone	EUR 345.00 EUR 3275.00 EUR 912.00 EUR 440.00 EUR 219.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: ADD1 (Thr99~Gln328) Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Adducin 1 (ADD1). This antibody is labeled with APC.

Adducin 1 (ADD1) Polyclonal Antibody (Human), Biotinylated
4-PAC280Hu01-Biotin	Cloud-Clone	EUR 311.00 EUR 2460.00 EUR 727.00 EUR 381.00 EUR 219.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: ADD1 (Thr99~Gln328) Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Adducin 1 (ADD1). This antibody is labeled with Biotin.

Adducin 1 (ADD1) Polyclonal Antibody (Human), Cy3
4-PAC280Hu01-Cy3	Cloud-Clone	EUR 419.00 EUR 4325.00 EUR 1175.00 EUR 545.00 EUR 251.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: ADD1 (Thr99~Gln328) Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Adducin 1 (ADD1). This antibody is labeled with Cy3.

Adducin 1 (ADD1) Polyclonal Antibody (Human), FITC
4-PAC280Hu01-FITC	Cloud-Clone	EUR 296.00 EUR 2640.00 EUR 750.00 EUR 372.00 EUR 195.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: ADD1 (Thr99~Gln328) Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Adducin 1 (ADD1). This antibody is labeled with FITC.

Adducin 1 (ADD1) Polyclonal Antibody (Human), HRP
4-PAC280Hu01-HRP	Cloud-Clone	EUR 316.00 EUR 2855.00 EUR 807.00 EUR 398.00 EUR 206.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: ADD1 (Thr99~Gln328) Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Adducin 1 (ADD1). This antibody is labeled with HRP.

Adducin 1 (ADD1) Polyclonal Antibody (Human), PE
4-PAC280Hu01-PE	Cloud-Clone	EUR 296.00 EUR 2640.00 EUR 750.00 EUR 372.00 EUR 195.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: ADD1 (Thr99~Gln328) Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Adducin 1 (ADD1). This antibody is labeled with PE.

Adducin 1 (ADD1) Polyclonal Antibody (Human, Mouse)
4-PAC280Mu01	Cloud-Clone	EUR 251.00 EUR 2576.00 EUR 640.00 EUR 316.00 EUR 215.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: ADD1 (Gly388~Gly560) Buffer composition: PBS, pH7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
Description: A Rabbit polyclonal antibody against Human, Mouse Adducin 1 (ADD1)

ADD1 Protein Vector (Human) (pPB-His-MBP)
PV320050	ABM	500 ng	EUR 329

ADD1 Protein Vector (Human) (pPB-His-GST)
PV320051	ABM	500 ng	EUR 329

ADD1 Protein Vector (Mouse) (pPB-C-His)
PV152638	ABM	500 ng	EUR 603

ADD1 Protein Vector (Mouse) (pPB-N-His)
PV152639	ABM	500 ng	EUR 603

ADD1 Protein Vector (Mouse) (pPM-C-HA)
PV152640	ABM	500 ng	EUR 603

ADD1 Protein Vector (Mouse) (pPM-C-His)
PV152641	ABM	500 ng	EUR 603

ADD1 Protein Vector (Mouse) (pPB-C-His)
PV152642	ABM	500 ng	EUR 1065

ADD1 Protein Vector (Mouse) (pPB-N-His)
PV152643	ABM	500 ng	EUR 1065

ADD1 Protein Vector (Mouse) (pPM-C-HA)
PV152644	ABM	500 ng	EUR 1065

ADD1 Protein Vector (Mouse) (pPM-C-His)
PV152645	ABM	500 ng	EUR 1065

ADD1 Protein Vector (Mouse) (pPB-C-His)
PV152646	ABM	500 ng	EUR 603

ADD1 Protein Vector (Mouse) (pPB-N-His)
PV152647	ABM	500 ng	EUR 603

ADD1 Protein Vector (Mouse) (pPM-C-HA)
PV152648	ABM	500 ng	EUR 603

ADD1 Protein Vector (Mouse) (pPM-C-His)
PV152649	ABM	500 ng	EUR 603

ADD1 Protein Vector (Rat) (pPB-C-His)
PV252414	ABM	500 ng	EUR 1166

ADD1 Protein Vector (Rat) (pPB-N-His)
PV252415	ABM	500 ng	EUR 1166

ADD1 Protein Vector (Rat) (pPM-C-HA)
PV252416	ABM	500 ng	EUR 1166

ADD1 Protein Vector (Rat) (pPM-C-His)
PV252417	ABM	500 ng	EUR 1166

Add1 3'UTR Luciferase Stable Cell Line
TU200315	ABM	1.0 ml	Ask for price

Add1 3'UTR GFP Stable Cell Line
TU151434	ABM	1.0 ml	Ask for price

ADD1 3'UTR Luciferase Stable Cell Line
TU000366	ABM	1.0 ml	EUR 2333

Add1 3'UTR Luciferase Stable Cell Line
TU101434	ABM	1.0 ml	Ask for price

ADD1 3'UTR GFP Stable Cell Line
TU050366	ABM	1.0 ml	EUR 2333

The presence of additional cytogenetic abnormalities did not modify the outcome of patients with favorable cytogenetics. Subgroup analysis demonstrated that the three cytogenetically defined prognostic groups retained their predictive value in the context of secondary as well as de novo AML, within the pediatric age group and furthermore were found to be a key determinant of outcome from autologous or allogeneic bone marrow transplantation (BMT) in first CR. This study highlights the importance of diagnostic cytogenetics as an independent prognostic factor in AML, providing the framework for a stratified treatment approach of this disease, which has been adopted in the current MRC AML 12 trial.